The Frequency of the mf2 Gene in Streptococcus pyogenes and the Correlation Between mf2 and speC in the Genome


by Melissa Cain


Classen School of Advanced Studies
Oklahoma City, OK
February 2000

Abstract
Erythrogenic toxin C (SpeC, or pyrogenic toxin C) is a phage encoded toxin that is present in about 50% of all Streptococcus pyogenes (group A streptococcus) strains and has been linked to severe streptococcal disease; however, few of the strains carrying the speC gene are actually associated with severe diseases like toxic shock syndrome. Through DNA sequencing of the complete genome of S. pyogenes at the University of Oklahoma, it was found that a previously unknown gene similar to another toxin, the mitogenic factor, is next to speC in the phage genome and was named mitogenic factor 2 (mf2).
    This experiment examines whether the genes for speC and mf2 are always found together or whether these genes can be found independent of each other. The presence of a new potential toxin gene next to speC that could potentially segregate independently of speC could help explain why the presence of this toxin is not invariably linked to disease.
    Polymerase Chain Reactions (PCR) were used to amplify a specific region of a genome so that mf2 and speC could be detected through gel electrophoresis.
    Approximately 47.5% of the 99 strains of S. pyogenes tested contained speC and 43.5% of the strains contained mf2. Five of the strains containing speC did not contain mf2, but only one of the strains with mf2 did not contain speC; indicating that speC and mf2 are probably linked genes. These results indicate that symptoms that have been attributed to speC could actually be the result of mf2 expression.   



Introduction
Bacteriophages (or phages) are viruses that infect bacterial cells . Phages fall into two main groups: lytic and temperate (5). Lytic phages behave like typical viruses, infecting their host cell, replicating new viruses, and finally rupturing (lysing) the host cell to release the newly formed phages (2). Temperate bacteriophages differ fundamentally from the lytic phages in that infection of the host bacterium can lead to two different outcomes (4). Sometimes phage replication proceeds immediately as in the lytic phages, leading to the lysis of the host and release of new virus particles. However, in response to favorable biological conditions, temperate phages can alternatively integrate a copy of their genome into a specific target site in the host chromosome, leading to the formation of a prophage (1, 2). The integrated phage genome remains integrated in the bacterial DNA, being replicated with the host genome and passed onto daughter cells (5).
    The temperate phages of Streptococcus pyogenes are of medical importance because toxin genes are often carried in the DNA of these phages (4). S. pyogenes (also known as the group A streptococcus) is an important human disease-causing bacteria, responsible for a range of infections from simple sore throat to life-threatening toxin shock syndrome (1, 5). The toxins carried by the temperate phages are often directly linked to specific streptococcal diseases.
    Erythrogenic toxin C (SpeC, also known as pyrogenic toxin C) is one of these phage encoded toxins that have been linked to severe streptococcal disease (6). Previous research has shown that this gene is present in about 50% of all S. pyogenes strains (3, 6); however, only a small number of the strains carrying the speC gene are actually associated with severe diseases like toxic shock syndrome (4). As a result of the recent DNA sequencing of the complete genome of S. pyogenes at the University of Oklahoma, it was found that a previously unknown gene is next to speC in the phage genome (3). This new gene is similar to a previously known gene that encodes another streptococcal toxin, the mitogenic factor. Because of this similarity, the new gene was named mitogenic factor 2 (mf2) (3).
    In this study we wanted to examine whether the genes for speC and mf2 were always found together or whether these genes could be found independent of each other. Further, we wanted to make an estimate of the frequency of these genes in a survey of streptococcal strains. The presence of a new potential toxin gene next to speC that could potentially segregate independently of speC could help explain why the presence of this toxin is not invariably linked to disease.
    The method used to perform the experiment was Polymerase Chain Reactions (PCR). PCR is a process that amplifies a specific region of a genome so specific genes can be detected through gel electrophoresis.
       

Materials and Methods
Cell Lysates. The DNA Lysates from 99 strains of Streptococcus pyogenes were prepared as follows. Strains were grown overnight in Todd Hewitt broth supplemented with 0.2% yeast extract supplemented with glycine at a concentration (0.5 -1.57%) to facilitate cell lysis. Bacterial cells were harvested by centrifugation at 12,000Xg and room temperature in a microcentrifuge for 3 min. The cell pellet was resuspended in 1 ml of 20% sucrose in STE (10 mM Tris · HCl pH 8.0; 100 mM NaCl; 1 mM EDTA pH 8.0) containing 25 mg/ml lysozyme and 50 U/ml Mutanolysin. After incubation at 37(C for 30-60 min., samples were centrifuged as previously and the pellet resuspended in 1 ml of lysis buffer (50 mM KCl; 10 mM Tris · HCl pH 8.3; 0.1 mg/ml gelatin; 0.45% Nonidet P-40; and 0.45% Tween 20 supplemented with 100 µg/ml of proteinase K). After incubation at 60(C for 60 min to complete cell lysis, the lysates were heated at 95(C for 10 min to inactivate proteinase K, any residual cellular proteases or nucleases, and to denature the target DNA.

Strain Database. Strains of Streptococcus pyogenes were from the collection of the University of Oklahoma Health Sciences Center, representing isolates collected world-wide. Many strains used in the current study had been previously characterized for the presence of speC (7). Strains whose genotype had not been characterized in that study were determined as part of the current work.

Synthetic DNA Primers.
The oligonucleotide primers used for PCR were:
MF1: 5' GTTTTTAGGAGTGGCAGTTCCA 3';
MF2: 5' ATCCGAATGTATCCCATGCAAA 3';
SPE1: 5' GCAAAAATATCTGATCTAGTCC 3';
SPE2: 5' GATTATAAAAATTGCAGGGTAA 3'

Polymerase Chain Reactions (PCR).
PCR were performed as follows:
1. Set-up 100 PCR reactions using 100 pre-made group A streptocci lysates:
2.5 µl 10x PCR Buffer
1 µl     50mM MgCl2
1 µl    10x dNTPs (deoxy-nucleotides)
2.5 µl primer #1
2.5 µl primer #2
14 µl    ddH2O (double-distilled)
0.5 µl    Taq Polymerase
1 µl    Lysate
(((((((
25 µl solution
2. Overlay each reaction with one drop of mineral oil.
3. Specific DNA fragments are amplified by PCR using the following cycle:
a. 3 min. at 94(C
b. Repeat 35 times:
15 sec. at 94(C
15 sec. at 55(C
20 sec. at 72(C
c. 5 min. at 72(C
        d. Hold at 4(C until sample is needed
4. Make agarose gel:
a. Mix
100 ml of 0.5 % TRIS Buffer EDTA
1 g Agarose Low EEO for gel electrophoresis
b. Microwave mixture for 2 min.
c. Add 2 µl of etBr
d. Swirl then pour into plate with comb inserted and let sit for 15 min.
5. Remove the comb and put the gel into 0.5 % TRIS Buffer EDTA
bath. Hook up plus and minus electrodes to opposite ends.
6. Add 25 µl of 1X DNA Sample Buffer (0.05% bromophenol blue, 5% ficoll 400, 0.05% sodium docecylsulfate, 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA) to each lysate mixture.
7. Load 10µl of each lysate in a well on the agarose gel and load 5µl of DNA kilobase ladder (Gibco) in one well for a molecular weight standard.
8. Separate the DNA by electrophoresis for 15 min. at 100 volts or until the sample has migrated sufficiently for band separation and indentification.
9. The DNA is visualized using UV illumination and photographed. The presence of a band indicates amplification of the specific DNA sequence in the tested lysate.

Data
Results from PCR reactions on 99 strains of S. pyogenes:
Frequency of mf2 and speC in Strains of Streptococcus pyogenesGeneNumber Percentagemf2+4343.43%speC+4747.47%mf2+ speC+4242.42%mf2+ speC–11.01%mf2– speC+55.05%Conclusion    We found that approximately 47.5% of the 99 strains of S. pyogenes tested contained speC and 43.5% of the strains contained mf2. Five of the strains containing speC did not contain mf2, but only one of the strains with mf2 did not contain speC; indicating that speC and mf2 are probably linked genes. It also shows that the presence of speC does not necessarily mean it will be accompanied by mf2, but the presence of mf2 almost always means that the genome will also contain speC.     
    The results indicate that symptoms of S. pyogenes that have been attributed to speC could actually be a result of mf2 expression. Scientists suspected that speC was one of the major virulence factors in S. pyogenes, but these findings show that mf2 could have as much influence over the symptoms of the disease as speC.
    The next step is to determine the expression patterns of mf2 and speC in strains of S. pyogenes. The expression of one, both, or neither gene will indicate the frequency of expression of the genes. From this data we will be able to determine if there is a correlation between the expression of these genes and the clinical effects of the examined strains of S. pyogenes.

Acknowledgements
    This project was performed under the supervision of Dr. Michael McShan in Dr. Joseph Ferretti's lab at the University of Oklahoma Health Sciences Center Department of Microbiology and Immunology. The cell lysates were prepared prior to experimentation by Dr. McShan for a different experiment.



References
1.    Evans, A. C. 1934. Streptococcus bacteriophage: A study of four seriological types. Public Health Reports. 49: 1386-1401
2.    Friend, P. L., and H. D. Slade. 1966. Characteristics of group A streptococcol bacteriophages. Journal of Bacteriology. 92: 148-154
3.    Liu, J. X. Ph.D. dissertation. University of Oklahoma.
4.    Maxted, W. R. 1955. The influence of bacteriophage on Streptococcus pyogenes. Journal of General Microbiology. 12: 484-495
5.    McShan, W. M.. 1999. The Bacteriophages of Group A Streptococci. Department of Microbiology and Immunology at the University of Oklahoma Health Sciences Center.
6.    McShan, W. M., and J. J. Feretti. 1997. Genetic Studies of Erythrogenic Toxin Carrying Temperate Bacteriophages of Streptococcus pyogenes, p. 971-973. In T. Horaud, A. Bouvet, R. Leclercq, H. d. Montclos, and M. Sicard (ed.), Streptococci and the Host. Plenum Publishing, New York.
7.    Yu, C. E., and J. J. Ferretti. 1991. Frequency of the erythrogenic toxin B and C genes (speB and speC) among clinical isolates of group A streptococci. Infection and Immunity. 59:211-215